Genetic Diversity of mtDNA of Donkeys in Sahel Agro-ecological Zone of Northeastern Nigeria

Adamu Jummai, Momoh Michael Ojoh, Noah Edson Terhemen Tor

Issue :

ASRIC Journal of Agricultural Sciences 2025 v6-i1

Journal Identifiers :

ISSN : 2795-3564

EISSN : 2795-3572

Published :

2025-12-31

Abstract

The molecular characterizations of the donkey in the Sahel agro-ecological zone of the north eastern Nigeria were assessed. A total of 20 adult donkeys were sampled through stratified random sampling in some part of Borno and Yobe States and were used for the molecular characterization. to reduce the genetic relationship among animals and to increase the breed representativeness. Blood samples was collected from the jugular vein and immediately transferred into EDTA bottles. Genomic DNA was extracted following the Accu prep Genomic DNA was extraction and polymerization using donkey MTF primer (Forward primer: 5’ TAGCTCCACCATCAACACCC 3’) (Reverse: 5’GCATTTTCAGTGCCTTGCT 3’). PCR amplicon was sequenced based on sanger di-deoxy chain termination method at (Inqaba Biotech laboratory in Pretoria south Africa) in West Africa. Bio edits program was used to check and edit ambiguous bases. ClustalW in MEGAX was used for multiple sequence alignments. Numbers of haplotypes, numbers of nucleotide polymorphic sites, haplotype diversity (h), and nucleotide diversity (π) were analyzed with DnaSP ver 6.0. A total of 16 sequences from the present study and together with 66 sequences from the gene bank were used for the above analysis. Borno/Yobe donkeys were highly polymorphic compared to donkeys from other locations of the World. The high haplotype diversity and low nucleotide diversity among the donkeys in the study area could be as a result of the differences in the wide geographical spread of the study area, environmental and genotype by environment interaction. It may also be as a result of rates of mutation, founder effect or sudden expansion of the population. Key words: Genetic diversity, Donkey, Mitochondrial DNA, Nucleotide diversity and Haplotype

Join our newsletter

Sign up for the latest news.